Reel Haritalama Tekniği

Herkese merhaba. Bugün size Sayısal Haritalama Tekniklerinden Sabit Haritalama Tekniği başlığı altındaki 2. yöntemi anlatacağım. Yani Reel Haritalama Tekniğini inceleyeceğiz. Ama bu konuya bakmadan önce Sayısal Haritalama Teknikleri yazımıza göz atmanızı konu bütünlüğü açısından öneririz. Gelin birlikte Reel Haritalama Tekniği’nin ne demek olduğunu anlamaya çalışalım.

Reel Haritalama Tekniği

Reel Haritalama Tekniği, Sabit Haritalama Tekniği altındaki 2. teknik çeşididir. Bu teknikte bir DNA dizilimdeki nükleotidler yani Adenin, Guanin, Sitozin Ve Timin belirli sayısal değerler alırlar. Aldıkları sayısal değerler  ” A=-1.5, T=1.5, C=0.5, G=-0.5 ” şeklindedir.  Örneğin aşağıdaki A(n) adıyla verilen DNA bazlarını bu yöntemi kullanarak sayısal işlemesini yapmaya çalışalım.

A[n]=(T G G A A C) şeklinde verilen bir dizilimin reel sayı temsilleri E[n]=(1.5  -0.5  -0.5  -1.5  -1.5  0.5 ) şeklinde ifade edilir. Ayrıca Reel ve Integer haritalama tekniklerinin belirliği bir özelliği vardır. Reel tekniğin doğal tamamlayıcı özelliği ve Integer tekniğinin tamamlayıcı olmayan özelliğinden dolayı farklı dizilim eşleşmeleri sağlar.

Reel Haritalama Tekniğimizin sayısal mantığı bu şekildedir. Peki koda nasıl entegre edeceğiz? Gelin birlikte MATLAB kullanarak kodlarımızı yazalım.

clear all;close all;clc

DNAS='GGAGCGCGTGAGGCTCCGGCGCGCAAGCCCGGAGCAGCCCGCTGGGGCGCACAGGGTCGCGCGGGCGCGGGGATGGAGGACGGCGTGGCCGGTCCCCAGCTCGGGGCCGCGGCGGAGGCGG';
 
sample_dna=DNAS; 
n=length(sample_dna);
numdna=[];
for i=1:n
    if sample_dna(i)=='A' 
       numdna(i)=-1.5;
      
    end
    if sample_dna(i)=='C' 
       numdna(i)=0.5;
       
    end
    if sample_dna(i)=='G' 
       numdna(i)=-0.5;
     
    end
    if sample_dna(i)=='T' 
      numdna(i)=1.5;
      
    end
end 
numdna
KODUN AÇIKLAMASI

Reel Haritalama Tekniğimizin kodlarının bir önceki yöntemimiz olan Integer tekniğinden daha kolay olduğunu fark edeceksiniz. Tek düşünmemiz gereken dışarıdan bir DNA baz dizilimi girişi alıyoruz. Daha sonra bu DNA ‘nın içinde bir for döngüsüyle dönerek “A” Görürsek A’nın indisini tutuyoruz. Numdna dizisindeki aynı indisine “A” ya karşılık gelen -1,5 değerini yazdırıyoruz. Tabii ki bu işlemleri “G , C ve T ” içinde yapıyoruz. DNA dizisinin uzunluğu için n değerini tutmuştuk. Bu sayede For döngümüzde n kadar DNA içinde dönerek görevini tamamlamış olacaktır. Daha sonra içinde sayısal değerleri tutan Numdna dizimizi yazdırıyoruz ve sonucumuza ulaşmış oluyoruz.

Kodlarımızın açıklaması bu şekildeydi. Anlam bütünlüğü açısından Sayısal Haritalama Tekniklerini anlattığımız yazımıza da bakmanızı öneririz. Eğer anlamadığınız bir kısım olursa bana buradan ulaşabilirsiniz. Hepinize sağlıklı günler dilerim ✿