Moleküler Haritalama Tekniği

Herkese tekrardan merhaba. Son zamanlarda üstüne sürekli yeni yazılar eklediğim bir konuya devam ediyoruz. Bugün Sayısal Haritalama Tekniklerinin alt başlığı olan Fiziko – Kimyasal Haritalama tekniklerinden bahsedeceğiz. Bu konuya bakmadan önce Sayısal Haritalama Teknikleri yazımıza anlam bütünlüğü açısından bakmanızı öneririz. Bu teknikten ikincisi Moleküler Haritalama Tekniği’dir. Gelin birlikte bu tekniğin ne olduğuna ve MATLAB kullanarak kodlarının nasıl yazıldığına bakalım.

Moleküler Haritalama Tekniği Nedir ?

Moleküler Haritalama Tekniğin’de DNA baz diziliminde bulunan her bir nükleotide sırasıyla ” Adenin = 134, Guanin = 150, (C) Sitozin = 110 ve Timin = 125 ” değerlerini alır.

Örnek verecek olursak:

Bize X(n)=[A T T G C G A] şeklinde bir DNA dizilimi verilsin. Moleküler Haritalama Tekniği kuralına göre Adenin, Timin, Sitozin ve Guanin için verilen değerleri yazalım. Bu DNA  diziliminin sayısal temsili: X(n)=[134 125 125 150 110 150 134] şeklinde olacaktır. Peki bu tekniğin kuralını, MATLAB kullanarak kodlarını nasıl yazacağız? Gelin birlikte anlamaya çalışalım.

clear all;close all;clc

DNAS='GGAGCGCGTGAGGCTCCGGCGCGCAAGCCCGGAGCAGCCCGCTGGGGCGCACAGGGTCGCGCGGGCGCGGGGATGGAGGACGGCGTGGCCGGTCCCCAGCTCGGGGCCGCGGCGGAGGCGG';
 
sample_dna=DNAS; 
n=length(sample_dna);
numdna=[];
for i=1:n
    if sample_dna(i)=='A' 
       numdna(i)=134;
      
    end
    if sample_dna(i)=='C' 
       numdna(i)=110;
       
    end
    if sample_dna(i)=='G' 
       numdna(i)=150;
     
    end
    if sample_dna(i)=='T' 
      numdna(i)=125;
      
    end
end 
numdna
Moleküler Haritalama Tekniği MATLAB Kodu

Gelin birlikte yazdığımız kodu anlamaya çalışalım.

Öncelikle dışarıdan bir DNA girişinin olması gerekiyor. Ancak bu giriş kullanacağınız veriye göre değişiklik gösterebilmektedir. Bizim yazdığımız örneğimizde bulunan “DNAS girişini biz oluşturduk. Ama isterseniz siz başka DNA baz değerlerini de giriş olarak alabilirsiniz. Daha sonra DNAS ‘ı sample_dna adlı değişkenimize ve sample_dna‘ nın uzunluğunu ‘n’ değerine atadık. Sonrasında Numdna adında bir dizi tanımladık. Bir döngü başlatarak i=1’den n’e kadar dönmesini sağladık. Döngünün içinde DNAS içinde bulunan Adenin, Timin, Sitozin ve Guanin bazları içinMoleküler Haritalama Tekniğinde bulunan kurala göre uygun sayısal değerleri atadık. Daha sonra bu değerleri aldıkça Numdna dizisine atayarak kurallı bir sıra oluşturduk. Döngümüz bittiğinde son olarak da Numdna dizisini ekrana bastırdık ve kodumuzu bitirmiş olduk.

Kodlarımızın açıklaması bu şekildeydi. Eğer fark edecek olursanız Atomik Haritalama Tekniği’ne çok benziyordu kodlar. Kendinizin de konuyu daha iyi anlayabilmesi için kodları tekrardan yazmanızı öneriyoruz. Eğer diğer yazılarımıza bakmadıysanız konu bütünlüğü açısından bakmanızı tavsiye ederiz. Sayısal Haritalama Tekniklerini sırasıyla anlatmaya devam ediyoruz. Sıradaki yazımızda DNA- Walk Haritalama Tekniği’ni anlatacağız. Kodlarla veyahut da konuyla ilgili anlamadığınız bir kısım olursa bana buradan ulaşabilirsiniz. Hepinize sağlıklı ve mutlu günler diliyorum ❤